Unusual Molecular Pathogenesis

From Iusmgenetics

(Difference between revisions)

Revision as of 13:20, 28 November 2011

Unusual Molecular Pathogenesis

Objectives

Know the concepts:
- Unstable repeat expansions
- Two hit phenomenon
- Alterened gene structure / dose from unusual crossover
Know the standard profile of each disease

Unstable repeat expansion

Unstable repeat expansion refers to the phenomenon of nucleotide repeats accumulating in a certain region of the genome and causing disease.
- Repeats can be at any location in the genome: non-coding regions, regulatory regions, introns, or exons.
- The repeats are usually triplets.
Note that this is a true instability in that repeats are added with each mitosis / meiosis.
- NB: instability can also result in decreases in repeats.
- Yes, indeed, even the germline cells have instability of these repeats.
The number of repeats usually correlates with severity of disease.
Repeat expansion leads to anticipation: earlier onset of disease with each generation.
Some expansions become interrupted by a second codon sequence (like in Fragile X syndrome, CGGs are interrupted by AGGs); interrupted repeats are less likely to expand.
In this group, some bases (e.g. a CAG triplet) are repeated in tandem multiple times (e.g.: (CAG)7).

When repeats result in coding regions, they are called poly amino acid tracts.
- It is estimated that 20% of human proteins contain a poly amino acid tract.
Poly amino acid tracts tend to manifest as neurologic disorders.
Some poly amino acid tracts demonstrate anticipation.
Poly amino acids tracts include:
- Huntington disease
- Spinocerebellar ataxia
- Spinobulbar muscle atrophy
- Macado-Joseph disease
- Dentorubropallido dysplasia

Myotonic Dystrophy

Fragile-X Syndrome

Huntington Disease

Two Hit Phenomenon

The concept of the two hit phenomenon is the idea that if a pt inherits one mutant allele, it only takes one "hit" at that locus to cause dieases; whereas if a pt has not inherited a mutant allele, two hits are required at the locus (which is highly unlikely) to cause disease.
- The second hit can result from the mutation of the wild-type allele or the deletion of the wild-type allele.
Loss of heterozygosity is related to the two hit phenomenon; LOH is the case when a pt has the same alleles at both copies of a loci.
- LOH can result from uniparental disomy, abnormal crossover events, etc.

Polycystic Kidney Disease

Neurofibromatosis

Hemophilia A

Gene duplication

Gene duplication can lead to disease.
Gene duplication may be facilitated by homologous sequences and / or repeats flanking a loci causing misalignment during synthesis and an attempt at "repair" generating a new copy.

Unusual Molecular Pathogenesis

From Iusmgenetics

Revision as of 13:20, 28 November 2011

Contents

Unusual Molecular Pathogenesis

Objectives

Unstable repeat expansion

Myotonic Dystrophy

Fragile-X Syndrome

Huntington Disease

Two Hit Phenomenon

Polycystic Kidney Disease

Neurofibromatosis

Hemophilia A

Gene duplication

Charcot-Marie-Tooth Disease

Views

Personal tools

Navigation

Search

EditThis.info tools

Toolbox

Other sites

@@ Line 18: / Line 18: @@
 *Repeat expansion leads to '''anticipation: earlier onset of disease with each generation'''.
 *Some expansions become interrupted by a second codon sequence (like in Fragile X syndrome, CGGs are interrupted by AGGs); '''interrupted repeats are less likely to expand'''.
+*In this group, some bases (e.g. a CAG triplet) are repeated in tandem multiple times (e.g.: (CAG)7).
 *When repeats result in coding regions, they are called '''poly amino acid tracts'''.
 **It is estimated that 20% of human proteins contain a poly amino acid tract.
+*Poly amino acid tracts tend to manifest as neurologic disorders.
+*Some poly amino acid tracts demonstrate anticipation.
 *Poly amino acids tracts include:
 **[[Huntington disease]]
@@ Line 52: / Line 55: @@
 ====[[Charcot-Marie-Tooth Disease]]====
-Unstable repeat expansion diseases  (Grouped together based on the molecular etiology of mutant allele formation)
-In this group, some bases (e.g., a CAG triplet) are repeated in tandem multiple times (e.g.,  (CAG)7).
-The repeat  may be at various locations in the gene
-Typically, disease symptoms are associated with increases in the number of repeats (i.e., expansion).
-…ATCATCAGCAGCAGCAGCAGCAGCAGTTGAGT…
-Myotonic Dystrophy (Autosomal Dominant, Multisystem Disorder)
-Progressive muscle weakness and wasting, begins in face (masklike) then generalized
-Myotonia
-Can’t relax after contraction
-Early cataracts
-Cardiac involvement
-  Conduction defects
-Endocrine/reproductive defects
- E.g., testicular atrophy
-Demonstrates “Anticipation”
-Most common inherited neuromuscular disorder of adult life
-Myotonic Female Face (600)
-Anticipation A phenomenon in which there is progressively earlier onset and/or increased severity of disease in successive generations of a family
-myotonic from t and t 300
-Three generations of a myotonic dystrophy family
-Fig 7-32 from Genetics in Medicine, Eds. Nussbaum McInnes, Willard
-Exons 1-14               Exon 15
-Translation stop
-Normal
-     n = 5-35 repeats
-Mutation/expansion
-       > 50 repeats
-Myotonic Dystrophy  (DMPK gene, DM protein kinase)
-(CTG)n
-’ UTR
-CTG expansion is in 3’ UTR (untranslated region, non-coding) part of gene.  Therefore, the protein sequence is normal.
-Alleles with 14 and 2100 repeats
-/69
-/84
-/75
-/112
-/205
-/160
-/300
-/200
-/2100
-/730
-I
-II
-III
-IV
-V
-Anticipation is explained at the molecular level because, in general, with larger expansions there is earlier onset and a more severe clinical picture
-Congential Myotonic Dystrophy:  The congenital (severe) form of disease comes  from maternal transmission.  The largest expansions happen during female       gametogenesis (gender specific).
-Alleles with 14 and 2100 repeats
-/69
-/84
-/75
-/112
-/205
-/160
-/300
-/200
-/2100
-/730
-There is instability in both germline and somatic cells, and, there can be reductions in size.
-I
-II
-III
-IV
-V
-•
-It is not simply haploinsufficiency
-•
-Mutant DMPK RNA accumulates in
- foci in the nucleus.
-–
-There is probably less DMPK protein
-–
-But, ….
-•
-Studies of mice –
-Knock-out mice do not mimic the
-human disease
-–
-Mice with an expansion more closely
-   mimic the human disease.
-–
-And, the repeat in a different context (i.e., associated with a different coding region) can still cause development of myotonia (in mice).
-Myotonic dystrophy pathogenesis
-TIG 20(10) 2004 path RNA
-Wide upward diagonal
-Coding region for Human Skeletal Actin
-Repeat from DMPK
-•
-“Expanded CUG repeats trigger aberrant splicing of CIC-1 chloride channel pre-mRNA and hyperexcitability of skeletal muscle in myotonic dystrophy.”   (E.g., Molecular Cell. 10:35) –
-CIC-1 is the main chloride channel in muscle.
-•
-And there is another gene DM2  (Myotonic dystrophy type 2) –
-Accounts for a small % of cases
-–
-Mutation is in gene ZNF9
-–
-Mutation is an expansion of a CCUG in the first intron of ZNF9
-–
-Expansion of the CCUG in the first intron of ZNF9 also results in disrupted processing of RNA of other genes
-Myotonic dystrophy pathogenesis (cont.)
-•
-This and other data supports a trans-dominant, RNA gain of (negative) function in myotonic dystrophy.     (toxic RNA)
-•
-Probably the first well-documented example of this pathogenic mechanism in humans
-AJHG 2004 74793 myotonic
-Summary: Multisystem disorder with complex pathogenesis
-Fragile-X Syndrome (Clinical Case Study #15)
-Called this because under certain conditions, an end of the X chromosome seems to be breaking off.
-frax chromo cartoon meh
-Mental retardation   Physical Findings (males)
-  Males moderate       Head somewhat large before
--6% of MR in boys with            puberty
-   positive family history of       Prominent ears, jaw and forehead
-   MR and no birth defects           after puberty
-  Females mild       Macroorchidism
-Behavioral Problems Inheritance pattern (Unusual)
- Hyperactivity, tantrums      Some obligate carrier males are
-     Autistic features          phenotypically normal.  Referred to as                “normal transmitting males” (NTM).
-/1250 males and 1/2000 females All ethnic groups
-Promoter       Exon 1                                   Exons 2-17
-ATG
-(CGG)n
-’ UTR
-The Fragile-X syndrome is caused by expansion of a triplet/trinucleotide (CGG) repeat in the 5’ untranslated region (UTR) of exon 1 of the FMR1 gene
-•
-  The pathogenic mechanism appears to involve “loss of function” of the  FMR1 gene or its gene product FMRP
-•
-  Gene is expressed in neurons as well as oligodendrocytes (myelin producing cells of CNS)
-•
-   FMRP is involved with the transport of mRNA of other genes
-•
-   A similar syndrome can be caused by rare FMR1 point mutations (mutant protein)
-The expansion may be small (e.g., a “premutation”) or large (e.g., a “full mutation”) [see next slide]
-Promoter        Exon 1
-Normal, n < 50 repeats  promoter unmethylated
-Premutation, n ~ 50-200 promoter unmethylated
-Full mutation, n > 200 promoter methylated
-x
-(CGG)n
-(Rest of gene)
-Transcription
-“Premutation” alleles are slightly expanded.  The gene can still be transcribed, but, is  potentially unstable and may expand further (e.g., to full mutation) in next generation
-Effect of different repeat sizes
-“Normal” alleles can vary inrepeat number
-Possibilities for exon 1
-“Full mutation” alleles have large expansions, are not transcribed, and cause Fragile- X syndrome
-In addition to germline instability, there can be somatic instability and thus patients may be mosaics of cell populations with differing numbers of repeats
-Wide upward diagonal
-Normal transmitting male (NTM) - Has premutation
-Unaffected female: Heterozygous for full mutation and normal allele
-Affected male: Full mutation
-Females who are heterozygotes for a full mutation and normal allele may or may not develop the syndrome (~50% mentally retarded).  Therefore, this disorder is not cleanly recessive or dominant.
-Wide upward diagonal
-Generally do not reproduce
-Female: Premutation Heterozygote
-X
-Large FMR1 expansions to full mutations are usually not seen through fathers.  There may be selection against passage of large alleles through the male germ line.
-Affected female:
-Heterozygous for full mutation and normal allele
-•
-  Larger premutation alleles are more likely to expand   Repeat size       Risk of expansion    50-69 repeats         <20 %   70-79                           39     80-89            76   90-99            89                  >99                         >99 %
-•
-   In addition, the CGG repeat region may be interrupted by AGG triplets in one or more places.  Interrupted repeats appear to be less likely to expand than uninterrupted repeats.
-   Risk of expansion during meiosis in female FMR1 premutation carriers
-More on premutations
-•
-Premutation carrier females are at 3-4 X increased risk for premature ovarian failure (POF) and early menopause.
-•Older premutation males may develop a neurodegenerative disorder known as Fragile X associated tremor/ataxia syndrome (FXTAS).  May occur in 25% (or more ?) of premutation males > age 50 yrs.  May also see in some female premutation carriers.
-•Some premutation carriers (perhaps as much as 25%) may have other manifestations such as mild cognitive and/or behavioral deficits.
-•So, the premutation state is not completely innocuous! –? RNA gain of negative function?
-Polyglutamine tract (CAG) triplet repeat diseases
-Huntington disease
-Spinocerebellar ataxia (multiple types)
-Spinobulbar muscular atrophy
-Macado-Joseph disease
-Dentorubropallido dysplasia
-Tend to be neurologic,
-some demonstrate anticipation
-Triplet  “repeats” also occur in coding regions (Result in poly “amino acid” tracts)
-It is estimated that ~ 20% of human proteins contain at least one such tract
-HD patient
-Autosomal dominant  (Late onset) Clinical features:  Progressive motor, cognitive and psychiatric abnormalities. Motor: Involuntary movements (chorea, 90% of patients) cannot be suppressed voluntarily.  Rigidity later in disease. Cognitive: All aspects.  Language later in course. Behavioral disturbances: Develop later in course.  Aggression, apathy, sexual deviation Psychiatric: personality changes, affective psychosis, schizophrenia  Survive 15-18 years after diagnosis
-Huntington Disease  (Clinical case study #15 in text)
-Normal:  10-26 CAG repeats         Premutation:  27-35 repeats Reduced penetrance: 36-41 repeats  Repeat size correlates with age of onset         Adult onset:  40-55 repeats         Juvenile onset:  >60 repeats  Gender-specific anticipation  New mutations are paternally derived  80% of juvenile cases are paternally derived  Penetrance is high with larger mutant alleles (e.g., >40 repeats) and if live long enough.   Ethical issues in genetic counseling   (Presymptomatic testing)
-Huntington Disease Mostly inherited (97%), new mutation (3%)
-Polycystic kidney disease (Clinical case study # 22 in text)
-•
-Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common dominant diseases in man.  1 / 300 - 1000 births
- (Accounts for 8-10% of end-stage renal disease in US)
-•
-Average onset in 4th decade but can present earlier
-•
-% penetrant by age 70 yr
-•
-Renal:  Cysts (100%, often bilateral) Blood in urine     Adenomas       Hypertension   Kidney stones
-•Systemic disorder:  can affect heart,
-    liver, pancreas, cerebral vasculature
-•Polycystic liver common (75%)
-~ 10 years after renal involvement.
-•Genes/mutations      –PKD1 (Polycystin-1, 85% of cases) •Many different mutations
-•No common one, a high mutation rate
-–PKD2 (Polycystin-2)
-fig C-21 PKD
-Graphic
-NEJM 347:1504 (2002)
-MRI
-apkd mbid fig 215-10 cyst origin
-Heterozygous Zygote
-Somatic tissues, including kidney tubule epithelium
-Two Hits
-Light upward diagonal
-Cell division, development
-Light upward diagonal
-Mut
-Norm
-Second hit in one cell
-Cyst
-apkd mbid fig 215-10 cyst origin
-•
- It has been found that in (at least some cases), there has been second hit that results in loss of function at the cellular level.
-•
-Second hit: (various possibilities)    Mutation of normal allele    Deletion of normal allele •
-Loss of Heterozygosity (LOH)
-•
-  Although two hits could also occur in a person who had not inherited a mutant allele, it would be rare.
-•
-  Other factors besides a second hit may also impact cyst formation.
-Neurofibromatosis (NF) (Two Types, I and II)  (Type I is most common, Clinical case study #29 )
- Type I: Peripheral Neurofibromatosis
-  (von Recklinhausen Disease)
-–
-Common, incidence of ca. 1 per 3500
-–
-Full penetrance, variable expressivity
-–
-Pleiotropy
-Neurologic, musculoskeletal, eye and
-skin abnormalities
-–
-Defining features
-  Café au lait spots  (skin hyperpigmentation, >95%)
-   [first to appear, 6 or more for diagnosis]
-  Neurofibromas  (peripheral nerve tumor, >95%)
-   [plexiform, subcutaneous, cutaneous]
-Lisch nodules  (pigmented nodules of iris, 90-95%)
-–
-Increased risk for certain neoplasms
-Optic nerve glioma, brain tumors, malignant myeloid disorders
-–
-Also other features: E.g., axillary freckling (not exposed to sun)
-NF clinical
-nf cafe-au-lait
-Neurofibromas
-Café au lait
-Lisch nodules
-Lisch nodules
-Pathogenesis
-    Due to loss of function
-    Can find “loss of heterozygosity” in  some tumors (two hits)
-     The activity of the normal allele is lost.    Will hear of this idea again for cancer.
-    May demonstrate segmental mosaicism
-NF1 gene (encodes neurofibromin)  Over 500 different mutations About 50% are new (de novo) mutations       (often unique to a family)  ~ 80% of de novo are paternal      (no apparent age effect) Typically a clinical diagnosis Tumor suppressor gene      One function is to regulate Ras
-NF mosaic AJHG 81:243-251 2007
-NF AJHG 81-444  600
-Hemophilia A (X-linked recessive, clinical case study # 18)
- If have 25% of factor VIII – normal
- Minimal symptoms till < 5% factor VIII
- <1% factor VIII, severe disease
-   (70% of cases)
-     frequent bleeding
-(spontaneous or after minimal trauma)
-    bleeding into joints (hemarthrosis) is
-      common
-hemophilia text 7-18
-Gene: Large, 186 kb, 26 exons
- Variety of mutations (large or small deletions, insertions,  missense, etc)
-•In 40-50% of severe cases, no FVIII mutation found by standard screens
-•Common inversion disrupts gene (~45% of cases)
-•Happens in male meiosis (paternal)
-Hemophilia A (cont) Unusual crossing over / recombination
-fig 6-2
-X chromosome before inversion
-See text page 180
-X chromosome after inversion
-Charcot-Marie-Tooth (CMT) disease (Hereditary motor and sensory neuropathy, HMSN) (Clinical case study # 6 in text)
-•
-Multiple HSMN types (dominant and recessive)
-  - Clinically variable presentation / severity
-•Type 1 (Autosomal dominant, CMT1)
-– Slowly progressive distal wasting and weakness first in the legs (arms later), difficulty walking, loss of reflexes, loss of sensation in limbs fingers and toes.
-–Segmental demyelination of nerves of the peripheral nervous system (PNS) often accompanied by altered nerve conduction velocities, hypertrophic changes and “onion bulb” formation.
-•CMT1 frequently (70-80%) caused by duplication of the gene for a structural protein of PNS myelin, PMP-22.
-fig C-4 CMT
-Wide upward diagonal
-Wide upward diagonal
-Wide upward diagonal
-PMP-22
-PMP-22
-PMP-22
-Chr 17
-Wide upward diagonal
-X
-Repeated sequences on each side of gene lead to misalignment, recombination and gene duplication
-PMP-22
-fam hyperchol text 7-12
-LDL receptor
-Fig 11-11
-Globin
-Alpha globin deletions are a cause of alpha thalassemia
-End