Unusual Molecular Pathogenesis

From Iusmgenetics

(Difference between revisions)

Revision as of 22:13, 18 October 2011

Unusual Molecular Pathogenesis

Objectives

Know the concepts:
- Unstable repeat expansions
- Two hit phenomenon
- Alterened gene structure / dose from unusual crossover
Know the standard profile of each disease

Unstable repeat expansion

Unstable repeat expansion refers to the phenomenon of nucleotide repeats accumulating in a certain region of the genome and causing disease.
- Repeats can be at any location in the genome: non-coding regions, regulatory regions, introns, or exons.
- The repeats are usually triplets.
Note that this is a true instability in that repeats are added with each mitosis / meiosis.
- NB: instability can also result in decreases in repeats.
- Yes, indeed, even the germline cells have instability of these repeats.
The number of repeats usually correlates with severity of disease.
Repeat expansion leads to anticipation: earlier onset of disease with each generation.
Some expansions become interrupted by a second codon sequence (like in Fragile X syndrome, CGGs are interrupted by AGGs); interrupted repeats are less likely to expand.

When repeats result in coding regions, they are called poly amino acid tracts.
- It is estimated that 20% of human proteins contain a poly amino acid tract.
Poly amino acids tracts include:
- Huntington disease
- Spinocerebellar ataxia
- Spinobulbar muscle atrophy
- Macado-Joseph disease
- Dentorubropallido dysplasia

Two Hit Phenomenon

The concept of the two hit phenomenon is the idea that if a pt inherits one mutant allele, it only takes one "hit" at that locus to cause dieases; whereas if a pt has not inherited a mutant allele, two hits are required at the locus (which is highly unlikely) to cause disease.
- The second hit can result from the mutation of the wild-type allele or the deletion of the wild-type allele.
Loss of heterozygosity is related to the two hit phenomenon; LOH is the case when a pt has the same alleles at both copies of a loci.
- LOH can result from uniparental disomy, abnormal crossover events, etc.

Unstable repeat expansion diseases (Grouped together based on the molecular etiology of mutant allele formation) In this group, some bases (e.g., a CAG triplet) are repeated in tandem multiple times (e.g., (CAG)7).

The repeat may be at various locations in the gene

Typically, disease symptoms are associated with increases in the number of repeats (i.e., expansion). …ATCATCAGCAGCAGCAGCAGCAGCAGTTGAGT…

Myotonic Dystrophy (Autosomal Dominant, Multisystem Disorder)

Progressive muscle weakness and wasting, begins in face (masklike) then generalized Myotonia Can’t relax after contraction Early cataracts Cardiac involvement

 Conduction defects

Endocrine/reproductive defects

E.g., testicular atrophy

Demonstrates “Anticipation”

Most common inherited neuromuscular disorder of adult life Myotonic Female Face (600) Anticipation A phenomenon in which there is progressively earlier onset and/or increased severity of disease in successive generations of a family

myotonic from t and t 300 Three generations of a myotonic dystrophy family Fig 7-32 from Genetics in Medicine, Eds. Nussbaum McInnes, Willard

Exons 1-14 Exon 15

Translation stop

Normal

    n = 5-35 repeats

Mutation/expansion

      > 50 repeats

Myotonic Dystrophy (DMPK gene, DM protein kinase)

(CTG)n

3’ UTR CTG expansion is in 3’ UTR (untranslated region, non-coding) part of gene. Therefore, the protein sequence is normal.

Alleles with 14 and 2100 repeats 24/69

5/84

5/75

13/112 13/205 5/160 13/300 16/200 14/2100

13/730

I

II

III

IV

V

Anticipation is explained at the molecular level because, in general, with larger expansions there is earlier onset and a more severe clinical picture

Congential Myotonic Dystrophy: The congenital (severe) form of disease comes from maternal transmission. The largest expansions happen during female gametogenesis (gender specific).

Alleles with 14 and 2100 repeats 24/69 5/84 5/75 13/112

13/205

5/160

13/300 16/200 14/2100 13/730

There is instability in both germline and somatic cells, and, there can be reductions in size. I

II

III

IV

V

• It is not simply haploinsufficiency

• Mutant DMPK RNA accumulates in

foci in the nucleus.

– There is probably less DMPK protein

– But, ….

• Studies of mice – Knock-out mice do not mimic the

human disease – Mice with an expansion more closely

  mimic the human disease.

– And, the repeat in a different context (i.e., associated with a different coding region) can still cause development of myotonia (in mice).

Myotonic dystrophy pathogenesis TIG 20(10) 2004 path RNA

Wide upward diagonal

Coding region for Human Skeletal Actin

Repeat from DMPK

• “Expanded CUG repeats trigger aberrant splicing of CIC-1 chloride channel pre-mRNA and hyperexcitability of skeletal muscle in myotonic dystrophy.” (E.g., Molecular Cell. 10:35) – CIC-1 is the main chloride channel in muscle.

• And there is another gene DM2 (Myotonic dystrophy type 2) – Accounts for a small % of cases

– Mutation is in gene ZNF9

– Mutation is an expansion of a CCUG in the first intron of ZNF9

– Expansion of the CCUG in the first intron of ZNF9 also results in disrupted processing of RNA of other genes

Myotonic dystrophy pathogenesis (cont.) • This and other data supports a trans-dominant, RNA gain of (negative) function in myotonic dystrophy. (toxic RNA)

• Probably the first well-documented example of this pathogenic mechanism in humans

AJHG 2004 74793 myotonic Summary: Multisystem disorder with complex pathogenesis

Fragile-X Syndrome (Clinical Case Study #15)

Called this because under certain conditions, an end of the X chromosome seems to be breaking off. frax chromo cartoon meh Mental retardation Physical Findings (males)

 Males moderate       Head somewhat large before  
   3-6% of MR in boys with            puberty 
  positive family history of       Prominent ears, jaw and forehead 
  MR and no birth defects           after puberty  
 Females mild       Macroorchidism

Behavioral Problems Inheritance pattern (Unusual)

Hyperactivity, tantrums      Some obligate carrier males are 
    Autistic features          phenotypically normal.  Referred to as                “normal transmitting males” (NTM).

1/1250 males and 1/2000 females All ethnic groups

Promoter Exon 1 Exons 2-17

ATG (CGG)n

5’ UTR

The Fragile-X syndrome is caused by expansion of a triplet/trinucleotide (CGG) repeat in the 5’ untranslated region (UTR) of exon 1 of the FMR1 gene

•

 The pathogenic mechanism appears to involve “loss of function” of the  FMR1 gene or its gene product FMRP

•

 Gene is expressed in neurons as well as oligodendrocytes (myelin producing cells of CNS)

•

  FMRP is involved with the transport of mRNA of other genes

•

  A similar syndrome can be caused by rare FMR1 point mutations (mutant protein)

The expansion may be small (e.g., a “premutation”) or large (e.g., a “full mutation”) [see next slide]

Promoter Exon 1

Normal, n < 50 repeats promoter unmethylated Premutation, n ~ 50-200 promoter unmethylated Full mutation, n > 200 promoter methylated

x

(CGG)n

(Rest of gene) Transcription

“Premutation” alleles are slightly expanded. The gene can still be transcribed, but, is potentially unstable and may expand further (e.g., to full mutation) in next generation Effect of different repeat sizes

“Normal” alleles can vary inrepeat number Possibilities for exon 1

“Full mutation” alleles have large expansions, are not transcribed, and cause Fragile- X syndrome

In addition to germline instability, there can be somatic instability and thus patients may be mosaics of cell populations with differing numbers of repeats

Wide upward diagonal

Normal transmitting male (NTM) - Has premutation

Unaffected female: Heterozygous for full mutation and normal allele

Affected male: Full mutation Females who are heterozygotes for a full mutation and normal allele may or may not develop the syndrome (~50% mentally retarded). Therefore, this disorder is not cleanly recessive or dominant.

Wide upward diagonal

Generally do not reproduce

Female: Premutation Heterozygote

X Large FMR1 expansions to full mutations are usually not seen through fathers. There may be selection against passage of large alleles through the male germ line.

Affected female: Heterozygous for full mutation and normal allele

•

 Larger premutation alleles are more likely to expand   Repeat size       Risk of expansion    50-69 repeats         <20 %   70-79                           39     80-89            76   90-99            89                  >99                         >99 %

•

  In addition, the CGG repeat region may be interrupted by AGG triplets in one or more places.  Interrupted repeats appear to be less likely to expand than uninterrupted repeats.

  Risk of expansion during meiosis in female FMR1 premutation carriers

More on premutations • Premutation carrier females are at 3-4 X increased risk for premature ovarian failure (POF) and early menopause.

•Older premutation males may develop a neurodegenerative disorder known as Fragile X associated tremor/ataxia syndrome (FXTAS). May occur in 25% (or more ?) of premutation males > age 50 yrs. May also see in some female premutation carriers.

•Some premutation carriers (perhaps as much as 25%) may have other manifestations such as mild cognitive and/or behavioral deficits.

•So, the premutation state is not completely innocuous! –? RNA gain of negative function?

Polyglutamine tract (CAG) triplet repeat diseases

Huntington disease

Spinocerebellar ataxia (multiple types) Spinobulbar muscular atrophy Macado-Joseph disease Dentorubropallido dysplasia

Tend to be neurologic, some demonstrate anticipation

Triplet “repeats” also occur in coding regions (Result in poly “amino acid” tracts) It is estimated that ~ 20% of human proteins contain at least one such tract

HD patient Autosomal dominant (Late onset) Clinical features: Progressive motor, cognitive and psychiatric abnormalities. Motor: Involuntary movements (chorea, 90% of patients) cannot be suppressed voluntarily. Rigidity later in disease. Cognitive: All aspects. Language later in course. Behavioral disturbances: Develop later in course. Aggression, apathy, sexual deviation Psychiatric: personality changes, affective psychosis, schizophrenia Survive 15-18 years after diagnosis Huntington Disease (Clinical case study #15 in text)

Normal: 10-26 CAG repeats Premutation: 27-35 repeats Reduced penetrance: 36-41 repeats Repeat size correlates with age of onset Adult onset: 40-55 repeats Juvenile onset: >60 repeats Gender-specific anticipation New mutations are paternally derived 80% of juvenile cases are paternally derived Penetrance is high with larger mutant alleles (e.g., >40 repeats) and if live long enough. Ethical issues in genetic counseling (Presymptomatic testing) Huntington Disease Mostly inherited (97%), new mutation (3%)

Polycystic kidney disease (Clinical case study # 22 in text)

• Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common dominant diseases in man. 1 / 300 - 1000 births

(Accounts for 8-10% of end-stage renal disease in US)

• Average onset in 4th decade but can present earlier

• 90% penetrant by age 70 yr

• Renal: Cysts (100%, often bilateral) Blood in urine Adenomas Hypertension Kidney stones

•Systemic disorder: can affect heart,

   liver, pancreas, cerebral vasculature

•Polycystic liver common (75%)

~ 10 years after renal involvement.

•Genes/mutations –PKD1 (Polycystin-1, 85% of cases) •Many different mutations

•No common one, a high mutation rate

–PKD2 (Polycystin-2)

fig C-21 PKD

Graphic NEJM 347:1504 (2002) MRI

apkd mbid fig 215-10 cyst origin Heterozygous Zygote Somatic tissues, including kidney tubule epithelium

Two Hits Light upward diagonal Cell division, development

Light upward diagonal

Mut Norm

Second hit in one cell

Cyst apkd mbid fig 215-10 cyst origin

•

It has been found that in (at least some cases), there has been second hit that results in loss of function at the cellular level.

• Second hit: (various possibilities) Mutation of normal allele Deletion of normal allele • Loss of Heterozygosity (LOH)

•

 Although two hits could also occur in a person who had not inherited a mutant allele, it would be rare.

•

 Other factors besides a second hit may also impact cyst formation.

Neurofibromatosis (NF) (Two Types, I and II) (Type I is most common, Clinical case study #29 )

Type I: Peripheral Neurofibromatosis 
 (von Recklinhausen Disease)

– Common, incidence of ca. 1 per 3500

– Full penetrance, variable expressivity

– Pleiotropy

Neurologic, musculoskeletal, eye and skin abnormalities – Defining features

 Café au lait spots  (skin hyperpigmentation, >95%) 
  [first to appear, 6 or more for diagnosis] 
 Neurofibromas  (peripheral nerve tumor, >95%) 
  [plexiform, subcutaneous, cutaneous]

Lisch nodules (pigmented nodules of iris, 90-95%) – Increased risk for certain neoplasms

Optic nerve glioma, brain tumors, malignant myeloid disorders – Also other features: E.g., axillary freckling (not exposed to sun)

NF clinical nf cafe-au-lait Neurofibromas

Café au lait Lisch nodules Lisch nodules

Pathogenesis

   Due to loss of function 
   Can find “loss of heterozygosity” in  some tumors (two hits) 
    The activity of the normal allele is lost.    Will hear of this idea again for cancer. 
   May demonstrate segmental mosaicism

NF1 gene (encodes neurofibromin) Over 500 different mutations About 50% are new (de novo) mutations (often unique to a family) ~ 80% of de novo are paternal (no apparent age effect) Typically a clinical diagnosis Tumor suppressor gene One function is to regulate Ras NF mosaic AJHG 81:243-251 2007 NF AJHG 81-444 600

Hemophilia A (X-linked recessive, clinical case study # 18)

If have 25% of factor VIII – normal 

Minimal symptoms till < 5% factor VIII 

<1% factor VIII, severe disease 
  (70% of cases) 
    frequent bleeding

(spontaneous or after minimal trauma)

   bleeding into joints (hemarthrosis) is 
     common

hemophilia text 7-18 Gene: Large, 186 kb, 26 exons

Variety of mutations (large or small deletions, insertions,  missense, etc)

•In 40-50% of severe cases, no FVIII mutation found by standard screens

•Common inversion disrupts gene (~45% of cases)

•Happens in male meiosis (paternal)

Hemophilia A (cont) Unusual crossing over / recombination fig 6-2 X chromosome before inversion See text page 180

X chromosome after inversion

Charcot-Marie-Tooth (CMT) disease (Hereditary motor and sensory neuropathy, HMSN) (Clinical case study # 6 in text)

• Multiple HSMN types (dominant and recessive)

 - Clinically variable presentation / severity

•Type 1 (Autosomal dominant, CMT1)

– Slowly progressive distal wasting and weakness first in the legs (arms later), difficulty walking, loss of reflexes, loss of sensation in limbs fingers and toes.

–Segmental demyelination of nerves of the peripheral nervous system (PNS) often accompanied by altered nerve conduction velocities, hypertrophic changes and “onion bulb” formation.

•CMT1 frequently (70-80%) caused by duplication of the gene for a structural protein of PNS myelin, PMP-22.

fig C-4 CMT

Wide upward diagonal Wide upward diagonal Wide upward diagonal PMP-22 PMP-22 PMP-22 Chr 17

Wide upward diagonal

X

Repeated sequences on each side of gene lead to misalignment, recombination and gene duplication PMP-22

fam hyperchol text 7-12 LDL receptor

Fig 11-11 Globin Alpha globin deletions are a cause of alpha thalassemia

End

@@ Line 17: / Line 17: @@
 *The '''number of repeats usually correlates with severity of disease'''.
 *Repeat expansion leads to '''anticipation: earlier onset of disease with each generation'''.
+*Some expansions become interrupted by a second codon sequence (like in Fragile X syndrome, CGGs are interrupted by AGGs); '''interrupted repeats are less likely to expand'''.
+*When repeats result in coding regions, they are called '''poly amino acid tracts'''.
+**It is estimated that 20% of human proteins contain a poly amino acid tract.
+*Poly amino acids tracts include:
+**[[Huntington disease]]
+**Spinocerebellar ataxia
+**Spinobulbar muscle atrophy
+**Macado-Joseph disease
+**Dentorubropallido dysplasia
 ====[[Myotonic Dystrophy]]====

Unusual Molecular Pathogenesis

From Iusmgenetics

Revision as of 22:13, 18 October 2011

Contents