Unusual Molecular Pathogenesis

From Iusmgenetics

(Difference between revisions)
(→Unstable repeat expansion)
 
(2 intermediate revisions not shown)
Line 18: Line 18:
*Repeat expansion leads to '''anticipation: earlier onset of disease with each generation'''.
*Repeat expansion leads to '''anticipation: earlier onset of disease with each generation'''.
*Some expansions become interrupted by a second codon sequence (like in Fragile X syndrome, CGGs are interrupted by AGGs); '''interrupted repeats are less likely to expand'''.
*Some expansions become interrupted by a second codon sequence (like in Fragile X syndrome, CGGs are interrupted by AGGs); '''interrupted repeats are less likely to expand'''.
 +
*In this group, some bases (e.g. a CAG triplet) are repeated in tandem multiple times (e.g.: (CAG)7).
*When repeats result in coding regions, they are called '''poly amino acid tracts'''.
*When repeats result in coding regions, they are called '''poly amino acid tracts'''.
**It is estimated that 20% of human proteins contain a poly amino acid tract.
**It is estimated that 20% of human proteins contain a poly amino acid tract.
 +
*Poly amino acid tracts tend to manifest as neurologic disorders.
 +
*Some poly amino acid tracts demonstrate anticipation.
*Poly amino acids tracts include:
*Poly amino acids tracts include:
**[[Huntington disease]]
**[[Huntington disease]]
Line 46: Line 49:
====[[Hemophilia A]]====
====[[Hemophilia A]]====
 +
 +
===Gene duplication===
 +
*Gene duplication can lead to disease.
 +
*Gene duplication may be facilitated by homologous sequences and / or repeats flanking a loci causing misalignment during synthesis and an attempt at "repair" generating a new copy.
====[[Charcot-Marie-Tooth Disease]]====
====[[Charcot-Marie-Tooth Disease]]====
-
Unstable repeat expansion diseases  (Grouped together based on the molecular etiology of mutant allele formation) 
+
====Miscellaneous====
-
In this group, some bases (e.g., a CAG triplet) are repeated in tandem multiple times (e.g.,  (CAG)7).
+
*Familial hypercholesterolemia is a product of LDL receptor issues.
-
 
+
*Alpha globin deletions lead to alpha thalassemias.
-
 
+
-
 
+
-
 
+
-
The repeat  may be at various locations in the gene
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Typically, disease symptoms are associated with increases in the number of repeats (i.e., expansion). 
+
-
…ATCATCAGCAGCAGCAGCAGCAGCAGTTGAGT…
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Myotonic Dystrophy (Autosomal Dominant, Multisystem Disorder)
+
-
 
+
-
Progressive muscle weakness and wasting, begins in face (masklike) then generalized
+
-
Myotonia     
+
-
Can’t relax after contraction
+
-
Early cataracts
+
-
Cardiac involvement
+
-
  Conduction defects 
+
-
Endocrine/reproductive defects
+
-
E.g., testicular atrophy
+
-
Demonstrates “Anticipation”
+
-
+
-
 
+
-
Most common inherited neuromuscular disorder of adult life
+
-
Myotonic Female Face (600)
+
-
Anticipation A phenomenon in which there is progressively earlier onset and/or increased severity of disease in successive generations of a family 
+
-
 
+
-
 
+
-
 
+
-
myotonic from t and t 300
+
-
Three generations of a myotonic dystrophy family
+
-
Fig 7-32 from Genetics in Medicine, Eds. Nussbaum McInnes, Willard
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Exons 1-14              Exon 15
+
-
 
+
-
Translation stop
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Normal
+
-
    n = 5-35 repeats 
+
-
 
+
-
Mutation/expansion
+
-
      > 50 repeats 
+
-
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Myotonic Dystrophy  (DMPK gene, DM protein kinase)
+
-
 
+
-
 
+
-
 
+
-
(CTG)n
+
-
 
+
-
3’ UTR
+
-
CTG expansion is in 3’ UTR (untranslated region, non-coding) part of gene.  Therefore, the protein sequence is normal.
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Alleles with 14 and 2100 repeats
+
-
24/69
+
-
 
+
-
5/84
+
-
 
+
-
5/75
+
-
 
+
-
13/112
+
-
13/205
+
-
5/160
+
-
13/300
+
-
16/200
+
-
14/2100
+
-
 
+
-
13/730
+
-
 
+
-
 
+
-
I
+
-
+
-
II
+
-
+
-
III
+
-
+
-
IV
+
-
+
-
V
+
-
 
+
-
Anticipation is explained at the molecular level because, in general, with larger expansions there is earlier onset and a more severe clinical picture
+
-
 
+
-
Congential Myotonic Dystrophy:  The congenital (severe) form of disease comes  from maternal transmission.  The largest expansions happen during female      gametogenesis (gender specific).
+
-
 
+
-
 
+
-
 
+
-
Alleles with 14 and 2100 repeats
+
-
24/69
+
-
5/84
+
-
5/75
+
-
13/112
+
-
 
+
-
13/205
+
-
 
+
-
5/160
+
-
 
+
-
13/300
+
-
16/200
+
-
14/2100
+
-
13/730
+
-
 
+
-
There is instability in both germline and somatic cells, and, there can be reductions in size.
+
-
I
+
-
+
-
II
+
-
+
-
III
+
-
+
-
IV
+
-
+
-
V
+
-
 
+
-
 
+
-
•
+
-
It is not simply haploinsufficiency 
+
-
 
+
-
•
+
-
Mutant DMPK RNA accumulates in
+
-
 
+
-
 
+
-
foci in the nucleus. 
+
-
–
+
-
There is probably less DMPK protein
+
-
 
+
-
–
+
-
But, …. 
+
-
 
+
-
 
+
-
•
+
-
Studies of mice –
+
-
Knock-out mice do not mimic the
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
human disease 
+
-
–
+
-
Mice with an expansion more closely
+
-
 
+
-
 
+
-
 
+
-
  mimic the human disease.
+
-
–
+
-
And, the repeat in a different context (i.e., associated with a different coding region) can still cause development of myotonia (in mice).
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Myotonic dystrophy pathogenesis
+
-
TIG 20(10) 2004 path RNA
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Wide upward diagonal
+
-
 
+
-
Coding region for Human Skeletal Actin 
+
-
 
+
-
Repeat from DMPK
+
-
 
+
-
 
+
-
•
+
-
“Expanded CUG repeats trigger aberrant splicing of CIC-1 chloride channel pre-mRNA and hyperexcitability of skeletal muscle in myotonic dystrophy.”  (E.g., Molecular Cell. 10:35) –
+
-
CIC-1 is the main chloride channel in muscle. 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
•
+
-
And there is another gene DM2  (Myotonic dystrophy type 2) –
+
-
Accounts for a small % of cases
+
-
 
+
-
–
+
-
Mutation is in gene ZNF9
+
-
 
+
-
–
+
-
Mutation is an expansion of a CCUG in the first intron of ZNF9
+
-
 
+
-
–
+
-
Expansion of the CCUG in the first intron of ZNF9 also results in disrupted processing of RNA of other genes   
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Myotonic dystrophy pathogenesis (cont.)
+
-
•
+
-
This and other data supports a trans-dominant, RNA gain of (negative) function in myotonic dystrophy.    (toxic RNA) 
+
-
 
+
-
•
+
-
Probably the first well-documented example of this pathogenic mechanism in humans
+
-
 
+
-
 
+
-
 
+
-
 
+
-
AJHG 2004 74793 myotonic
+
-
Summary: Multisystem disorder with complex pathogenesis
+
-
 
+
-
 
+
-
Fragile-X Syndrome (Clinical Case Study #15) 
+
-
 
+
-
 
+
-
Called this because under certain conditions, an end of the X chromosome seems to be breaking off. 
+
-
frax chromo cartoon meh
+
-
Mental retardation  Physical Findings (males)
+
-
  Males moderate      Head somewhat large before 
+
-
    3-6% of MR in boys with            puberty
+
-
  positive family history of      Prominent ears, jaw and forehead
+
-
  MR and no birth defects          after puberty 
+
-
  Females mild      Macroorchidism
+
-
+
-
Behavioral Problems Inheritance pattern (Unusual)
+
-
Hyperactivity, tantrums      Some obligate carrier males are
+
-
    Autistic features          phenotypically normal.  Referred to as                “normal transmitting males” (NTM).
+
-
 
+
-
1/1250 males and 1/2000 females All ethnic groups
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Promoter      Exon 1                                  Exons 2-17
+
-
 
+
-
 
+
-
ATG 
+
-
(CGG)n
+
-
 
+
-
5’ UTR
+
-
 
+
-
The Fragile-X syndrome is caused by expansion of a triplet/trinucleotide (CGG) repeat in the 5’ untranslated region (UTR) of exon 1 of the FMR1 gene
+
-
 
+
-
•
+
-
  The pathogenic mechanism appears to involve “loss of function” of the  FMR1 gene or its gene product FMRP 
+
-
 
+
-
•
+
-
  Gene is expressed in neurons as well as oligodendrocytes (myelin producing cells of CNS) 
+
-
 
+
-
•
+
-
  FMRP is involved with the transport of mRNA of other genes 
+
-
 
+
-
•
+
-
  A similar syndrome can be caused by rare FMR1 point mutations (mutant protein) 
+
-
 
+
-
 
+
-
 
+
-
The expansion may be small (e.g., a “premutation”) or large (e.g., a “full mutation”) [see next slide]
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Promoter        Exon 1                                 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Normal, n < 50 repeats  promoter unmethylated
+
-
Premutation, n ~ 50-200 promoter unmethylated
+
-
Full mutation, n > 200 promoter methylated
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
x
+
-
 
+
-
(CGG)n
+
-
 
+
-
 
+
-
 
+
-
 
+
-
(Rest of gene)
+
-
Transcription
+
-
 
+
-
 
+
-
 
+
-
 
+
-
“Premutation” alleles are slightly expanded.  The gene can still be transcribed, but, is  potentially unstable and may expand further (e.g., to full mutation) in next generation
+
-
Effect of different repeat sizes
+
-
 
+
-
“Normal” alleles can vary inrepeat number
+
-
Possibilities for exon 1
+
-
 
+
-
 
+
-
“Full mutation” alleles have large expansions, are not transcribed, and cause Fragile- X syndrome
+
-
 
+
-
 
+
-
 
+
-
 
+
-
In addition to germline instability, there can be somatic instability and thus patients may be mosaics of cell populations with differing numbers of repeats
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Wide upward diagonal
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Normal transmitting male (NTM) - Has premutation
+
-
 
+
-
Unaffected female: Heterozygous for full mutation and normal allele
+
-
 
+
-
 
+
-
Affected male: Full mutation
+
-
Females who are heterozygotes for a full mutation and normal allele may or may not develop the syndrome (~50% mentally retarded).  Therefore, this disorder is not cleanly recessive or dominant.
+
-
 
+
-
 
+
-
 
+
-
Wide upward diagonal
+
-
 
+
-
 
+
-
 
+
-
Generally do not reproduce
+
-
 
+
-
 
+
-
Female: Premutation Heterozygote
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
X
+
-
Large FMR1 expansions to full mutations are usually not seen through fathers.  There may be selection against passage of large alleles through the male germ line.
+
-
 
+
-
Affected female:
+
-
Heterozygous for full mutation and normal allele
+
-
 
+
-
 
+
-
 
+
-
•
+
-
  Larger premutation alleles are more likely to expand  Repeat size      Risk of expansion    50-69 repeats        <20 %  70-79                          39    80-89            76  90-99            89                  >99                        >99 % 
+
-
 
+
-
•
+
-
  In addition, the CGG repeat region may be interrupted by AGG triplets in one or more places.  Interrupted repeats appear to be less likely to expand than uninterrupted repeats. 
+
-
 
+
-
 
+
-
 
+
-
  Risk of expansion during meiosis in female FMR1 premutation carriers
+
-
 
+
-
More on premutations 
+
-
•
+
-
Premutation carrier females are at 3-4 X increased risk for premature ovarian failure (POF) and early menopause.   
+
-
 
+
-
 
+
-
+
-
•Older premutation males may develop a neurodegenerative disorder known as Fragile X associated tremor/ataxia syndrome (FXTAS).  May occur in 25% (or more ?) of premutation males > age 50 yrs.  May also see in some female premutation carriers. 
+
-
 
+
-
 
+
-
+
-
•Some premutation carriers (perhaps as much as 25%) may have other manifestations such as mild cognitive and/or behavioral deficits. 
+
-
 
+
-
•So, the premutation state is not completely innocuous! –? RNA gain of negative function? 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Polyglutamine tract (CAG) triplet repeat diseases
+
-
 
+
-
Huntington disease
+
-
+
-
Spinocerebellar ataxia (multiple types)
+
-
Spinobulbar muscular atrophy
+
-
Macado-Joseph disease
+
-
Dentorubropallido dysplasia
+
-
 
+
-
Tend to be neurologic,
+
-
some demonstrate anticipation
+
-
 
+
-
Triplet  “repeats” also occur in coding regions (Result in poly “amino acid” tracts)
+
-
It is estimated that ~ 20% of human proteins contain at least one such tract
+
-
 
+
-
 
+
-
HD patient
+
-
Autosomal dominant  (Late onset) Clinical features:  Progressive motor, cognitive and psychiatric abnormalities. Motor: Involuntary movements (chorea, 90% of patients) cannot be suppressed voluntarily.  Rigidity later in disease. Cognitive: All aspects.  Language later in course. Behavioral disturbances: Develop later in course.  Aggression, apathy, sexual deviation Psychiatric: personality changes, affective psychosis, schizophrenia  Survive 15-18 years after diagnosis 
+
-
Huntington Disease  (Clinical case study #15 in text)
+
-
 
+
-
 
+
-
 
+
-
Normal:  10-26 CAG repeats        Premutation:  27-35 repeats Reduced penetrance: 36-41 repeats  Repeat size correlates with age of onset        Adult onset:  40-55 repeats        Juvenile onset:  >60 repeats  Gender-specific anticipation  New mutations are paternally derived  80% of juvenile cases are paternally derived  Penetrance is high with larger mutant alleles (e.g., >40 repeats) and if live long enough.  Ethical issues in genetic counseling  (Presymptomatic testing) 
+
-
Huntington Disease Mostly inherited (97%), new mutation (3%)
+
-
 
+
-
Polycystic kidney disease (Clinical case study # 22 in text)
+
-
 
+
-
•
+
-
Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common dominant diseases in man. 1 / 300 - 1000 births
+
-
 
+
-
 
+
-
(Accounts for 8-10% of end-stage renal disease in US)
+
-
+
-
•
+
-
Average onset in 4th decade but can present earlier 
+
-
 
+
-
•
+
-
90% penetrant by age 70 yr 
+
-
 
+
-
•
+
-
Renal:  Cysts (100%, often bilateral) Blood in urine    Adenomas      Hypertension  Kidney stones
+
-
 
+
-
 
+
-
 
+
-
•Systemic disorder:  can affect heart,
+
-
 
+
-
 
+
-
    liver, pancreas, cerebral vasculature 
+
-
•Polycystic liver common (75%) 
+
-
 
+
-
 
+
-
~ 10 years after renal involvement.
+
-
+
-
•Genes/mutations      –PKD1 (Polycystin-1, 85% of cases) •Many different mutations
+
-
 
+
-
•No common one, a high mutation rate
+
-
 
+
-
 
+
-
 
+
-
 
+
-
–PKD2 (Polycystin-2)
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
fig C-21 PKD
+
-
 
+
-
Graphic
+
-
NEJM 347:1504 (2002)
+
-
MRI
+
-
 
+
-
 
+
-
apkd mbid fig 215-10 cyst origin
+
-
Heterozygous Zygote
+
-
Somatic tissues, including kidney tubule epithelium
+
-
 
+
-
Two Hits
+
-
Light upward diagonal
+
-
Cell division, development
+
-
 
+
-
Light upward diagonal
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Mut
+
-
Norm
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Second hit in one cell
+
-
 
+
-
 
+
-
Cyst
+
-
apkd mbid fig 215-10 cyst origin
+
-
 
+
-
 
+
-
 
+
-
 
+
-
•
+
-
It has been found that in (at least some cases), there has been second hit that results in loss of function at the cellular level.
+
-
 
+
-
•
+
-
Second hit: (various possibilities)    Mutation of normal allele    Deletion of normal allele •
+
-
Loss of Heterozygosity (LOH) 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
•
+
-
  Although two hits could also occur in a person who had not inherited a mutant allele, it would be rare.
+
-
 
+
-
•
+
-
  Other factors besides a second hit may also impact cyst formation. 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
Neurofibromatosis (NF) (Two Types, I and II)  (Type I is most common, Clinical case study #29 )
+
-
Type I: Peripheral Neurofibromatosis
+
-
  (von Recklinhausen Disease) 
+
-
–
+
-
Common, incidence of ca. 1 per 3500
+
-
 
+
-
–
+
-
Full penetrance, variable expressivity
+
-
 
+
-
–
+
-
Pleiotropy
+
-
 
+
-
 
+
-
 
+
-
Neurologic, musculoskeletal, eye and
+
-
skin abnormalities
+
-
–
+
-
Defining features
+
-
 
+
-
 
+
-
 
+
-
  Café au lait spots  (skin hyperpigmentation, >95%)
+
-
  [first to appear, 6 or more for diagnosis]
+
-
  Neurofibromas  (peripheral nerve tumor, >95%)
+
-
  [plexiform, subcutaneous, cutaneous]
+
-
Lisch nodules  (pigmented nodules of iris, 90-95%)
+
-
–
+
-
Increased risk for certain neoplasms
+
-
 
+
-
 
+
-
 
+
-
Optic nerve glioma, brain tumors, malignant myeloid disorders 
+
-
–
+
-
Also other features: E.g., axillary freckling (not exposed to sun) 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
NF clinical
+
-
nf cafe-au-lait
+
-
Neurofibromas
+
-
 
+
-
Café au lait
+
-
Lisch nodules
+
-
Lisch nodules
+
-
 
+
-
Pathogenesis
+
-
    Due to loss of function
+
-
    Can find “loss of heterozygosity” in  some tumors (two hits)
+
-
    The activity of the normal allele is lost.    Will hear of this idea again for cancer.
+
-
    May demonstrate segmental mosaicism
+
-
 
+
-
NF1 gene (encodes neurofibromin)  Over 500 different mutations About 50% are new (de novo) mutations      (often unique to a family)  ~ 80% of de novo are paternal      (no apparent age effect) Typically a clinical diagnosis Tumor suppressor gene      One function is to regulate Ras
+
-
NF mosaic AJHG 81:243-251 2007
+
-
NF AJHG 81-444  600
+
-
 
+
-
Hemophilia A (X-linked recessive, clinical case study # 18)
+
-
If have 25% of factor VIII – normal
+
-
+
-
Minimal symptoms till < 5% factor VIII
+
-
+
-
<1% factor VIII, severe disease
+
-
  (70% of cases)
+
-
    frequent bleeding
+
-
(spontaneous or after minimal trauma)
+
-
    bleeding into joints (hemarthrosis) is
+
-
      common
+
-
 
+
-
hemophilia text 7-18
+
-
Gene: Large, 186 kb, 26 exons
+
-
Variety of mutations (large or small deletions, insertions,  missense, etc)
+
-
 
+
-
 
+
-
+
-
•In 40-50% of severe cases, no FVIII mutation found by standard screens
+
-
 
+
-
 
+
-
+
-
•Common inversion disrupts gene (~45% of cases)
+
-
 
+
-
 
+
-
+
-
•Happens in male meiosis (paternal)
+
-
 
+
-
 
+
-
 
+
-
Hemophilia A (cont) Unusual crossing over / recombination
+
-
fig 6-2
+
-
X chromosome before inversion
+
-
See text page 180
+
-
 
+
-
X chromosome after inversion
+
-
 
+
-
 
+
-
 
+
-
Charcot-Marie-Tooth (CMT) disease (Hereditary motor and sensory neuropathy, HMSN) (Clinical case study # 6 in text)
+
-
 
+
-
•
+
-
Multiple HSMN types (dominant and recessive)
+
-
 
+
-
 
+
-
  - Clinically variable presentation / severity
+
-
 
+
-
•Type 1 (Autosomal dominant, CMT1)
+
-
 
+
-
 
+
-
+
-
– Slowly progressive distal wasting and weakness first in the legs (arms later), difficulty walking, loss of reflexes, loss of sensation in limbs fingers and toes.
+
-
 
+
-
–Segmental demyelination of nerves of the peripheral nervous system (PNS) often accompanied by altered nerve conduction velocities, hypertrophic changes and “onion bulb” formation. 
+
-
 
+
-
 
+
-
•CMT1 frequently (70-80%) caused by duplication of the gene for a structural protein of PNS myelin, PMP-22.
+
-
 
+
-
 
+
-
 
+
-
fig C-4 CMT
+
-
 
+
-
 
+
-
 
+
-
Wide upward diagonal
+
-
Wide upward diagonal
+
-
Wide upward diagonal
+
-
PMP-22
+
-
PMP-22
+
-
PMP-22
+
-
Chr 17
+
-
 
+
-
 
+
-
 
+
-
Wide upward diagonal
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
X
+
-
 
+
-
Repeated sequences on each side of gene lead to misalignment, recombination and gene duplication
+
-
PMP-22
+
-
 
+
-
 
+
-
fam hyperchol text 7-12
+
-
LDL receptor
+
-
 
+
-
 
+
-
Fig 11-11
+
-
Globin
+
-
Alpha globin deletions are a cause of alpha thalassemia
+
-
 
+
-
End
+

Current revision as of 13:24, 28 November 2011

Contents

[edit] Unusual Molecular Pathogenesis

[edit] Objectives

  • Know the concepts:
    • Unstable repeat expansions
    • Two hit phenomenon
    • Alterened gene structure / dose from unusual crossover
  • Know the standard profile of each disease

[edit] Unstable repeat expansion

  • Unstable repeat expansion refers to the phenomenon of nucleotide repeats accumulating in a certain region of the genome and causing disease.
    • Repeats can be at any location in the genome: non-coding regions, regulatory regions, introns, or exons.
    • The repeats are usually triplets.
  • Note that this is a true instability in that repeats are added with each mitosis / meiosis.
    • NB: instability can also result in decreases in repeats.
    • Yes, indeed, even the germline cells have instability of these repeats.
  • The number of repeats usually correlates with severity of disease.
  • Repeat expansion leads to anticipation: earlier onset of disease with each generation.
  • Some expansions become interrupted by a second codon sequence (like in Fragile X syndrome, CGGs are interrupted by AGGs); interrupted repeats are less likely to expand.
  • In this group, some bases (e.g. a CAG triplet) are repeated in tandem multiple times (e.g.: (CAG)7).


  • When repeats result in coding regions, they are called poly amino acid tracts.
    • It is estimated that 20% of human proteins contain a poly amino acid tract.
  • Poly amino acid tracts tend to manifest as neurologic disorders.
  • Some poly amino acid tracts demonstrate anticipation.
  • Poly amino acids tracts include:
    • Huntington disease
    • Spinocerebellar ataxia
    • Spinobulbar muscle atrophy
    • Macado-Joseph disease
    • Dentorubropallido dysplasia

[edit] Myotonic Dystrophy

[edit] Fragile-X Syndrome

[edit] Huntington Disease

[edit] Two Hit Phenomenon

  • The concept of the two hit phenomenon is the idea that if a pt inherits one mutant allele, it only takes one "hit" at that locus to cause dieases; whereas if a pt has not inherited a mutant allele, two hits are required at the locus (which is highly unlikely) to cause disease.
    • The second hit can result from the mutation of the wild-type allele or the deletion of the wild-type allele.
  • Loss of heterozygosity is related to the two hit phenomenon; LOH is the case when a pt has the same alleles at both copies of a loci.
    • LOH can result from uniparental disomy, abnormal crossover events, etc.

[edit] Polycystic Kidney Disease

[edit] Neurofibromatosis

[edit] Hemophilia A

[edit] Gene duplication

  • Gene duplication can lead to disease.
  • Gene duplication may be facilitated by homologous sequences and / or repeats flanking a loci causing misalignment during synthesis and an attempt at "repair" generating a new copy.

[edit] Charcot-Marie-Tooth Disease

[edit] Miscellaneous

  • Familial hypercholesterolemia is a product of LDL receptor issues.
  • Alpha globin deletions lead to alpha thalassemias.
Retrieved from "http://editthis.info/iusmgenetics/Unusual_Molecular_Pathogenesis"
Personal tools