Editing Unusual Molecular Pathogenesis

==Unusual Molecular Pathogenesis==

===Objectives===
*Know the concepts:
**Unstable repeat expansions
**Two hit phenomenon
**Alterened gene structure / dose from unusual crossover
*Know the standard profile of each disease

===Unstable repeat expansion===
*Unstable repeat expansion refers to the phenomenon of nucleotide repeats accumulating in a certain region of the genome and causing disease.
**Repeats can be at any location in the genome: non-coding regions, regulatory regions, introns, or exons.
**The repeats are usually triplets.
*Note that this is a true '''instability''' in that repeats are added with each mitosis / meiosis.
**NB: instability can also result in ''decreases in repeats''.
**Yes, indeed, '''even the germline cells have instability of these repeats'''.
*The '''number of repeats usually correlates with severity of disease'''.
*Repeat expansion leads to '''anticipation: earlier onset of disease with each generation'''.
*Some expansions become interrupted by a second codon sequence (like in Fragile X syndrome, CGGs are interrupted by AGGs); '''interrupted repeats are less likely to expand'''.


*When repeats result in coding regions, they are called '''poly amino acid tracts'''.
**It is estimated that 20% of human proteins contain a poly amino acid tract.
*Poly amino acids tracts include:
**[[Huntington disease]]
**Spinocerebellar ataxia
**Spinobulbar muscle atrophy
**Macado-Joseph disease
**Dentorubropallido dysplasia

====[[Myotonic Dystrophy]]====

====[[Fragile-X Syndrome]]====

====[[Huntington Disease]]====

===Two Hit Phenomenon===
*The concept of the two hit phenomenon is the idea that if a pt inherits one mutant allele, it only takes one "hit" at that locus to cause dieases; whereas if a pt has not inherited a mutant allele, two hits are required at the locus (which is highly unlikely) to cause disease.
**The second hit can result from the mutation of the wild-type allele or the deletion of the wild-type allele.
*Loss of heterozygosity is related to the two hit phenomenon; LOH is the case when a pt has the same alleles at both copies of a loci.
**LOH can result from uniparental disomy, abnormal crossover events, etc.

====[[Polycystic Kidney Disease]]====

====[[Neurofibromatosis]]====

====[[Hemophilia A]]====

====[[Charcot-Marie-Tooth Disease]]====

Unstable repeat expansion diseases  (Grouped together based on the molecular etiology of mutant allele formation)   
In this group, some bases (e.g., a CAG triplet) are repeated in tandem multiple times (e.g.,  (CAG)7). 




The repeat  may be at various locations in the gene 




Typically, disease symptoms are associated with increases in the number of repeats (i.e., expansion).   
…ATCATCAGCAGCAGCAGCAGCAGCAGTTGAGT… 









Myotonic Dystrophy (Autosomal Dominant, Multisystem Disorder) 

Progressive muscle weakness and wasting, begins in face (masklike) then generalized 
Myotonia       
Can’t relax after contraction 
Early cataracts 
Cardiac involvement 
  Conduction defects  
Endocrine/reproductive defects 
 E.g., testicular atrophy 
Demonstrates “Anticipation” 
 

Most common inherited neuromuscular disorder of adult life 
Myotonic Female Face (600)
Anticipation A phenomenon in which there is progressively earlier onset and/or increased severity of disease in successive generations of a family  



myotonic from t and t 300
Three generations of a myotonic dystrophy family 
Fig 7-32 from Genetics in Medicine, Eds. Nussbaum McInnes, Willard 







Exons 1-14               Exon 15 

Translation stop 






Normal 
     n = 5-35 repeats  

Mutation/expansion 
       > 50 repeats  
 






Myotonic Dystrophy  (DMPK gene, DM protein kinase) 



(CTG)n 

3’ UTR 
CTG expansion is in 3’ UTR (untranslated region, non-coding) part of gene.  Therefore, the protein sequence is normal. 




Alleles with 14 and 2100 repeats 
24/69 

5/84 

5/75 

13/112 
13/205 
5/160 
13/300 
16/200 
14/2100 

13/730 


I 
 
II 
 
III 
 
IV 
 
V 

Anticipation is explained at the molecular level because, in general, with larger expansions there is earlier onset and a more severe clinical picture 

Congential Myotonic Dystrophy:  The congenital (severe) form of disease comes  from maternal transmission.  The largest expansions happen during female       gametogenesis (gender specific). 



Alleles with 14 and 2100 repeats 
24/69 
5/84 
5/75 
13/112 

13/205 

5/160 

13/300 
16/200 
14/2100 
13/730 

There is instability in both germline and somatic cells, and, there can be reductions in size. 
I 
 
II 
 
III 
 
IV 
 
V 


•
It is not simply haploinsufficiency  

•
Mutant DMPK RNA accumulates in 


 foci in the nucleus.  
–
There is probably less DMPK protein 

–
But, ….  


•
Studies of mice –
Knock-out mice do not mimic the 





human disease  
–
Mice with an expansion more closely 



   mimic the human disease. 
–
And, the repeat in a different context (i.e., associated with a different coding region) can still cause development of myotonia (in mice). 




Myotonic dystrophy pathogenesis 
TIG 20(10) 2004 path RNA





Wide upward diagonal

Coding region for Human Skeletal Actin   

Repeat from DMPK 


•
“Expanded CUG repeats trigger aberrant splicing of CIC-1 chloride channel pre-mRNA and hyperexcitability of skeletal muscle in myotonic dystrophy.”   (E.g., Molecular Cell. 10:35) –
CIC-1 is the main chloride channel in muscle.  




•
And there is another gene DM2  (Myotonic dystrophy type 2) –
Accounts for a small % of cases 

–
Mutation is in gene ZNF9 

–
Mutation is an expansion of a CCUG in the first intron of ZNF9 

–
Expansion of the CCUG in the first intron of ZNF9 also results in disrupted processing of RNA of other genes    






Myotonic dystrophy pathogenesis (cont.) 
•
This and other data supports a trans-dominant, RNA gain of (negative) function in myotonic dystrophy.     (toxic RNA)  

•
Probably the first well-documented example of this pathogenic mechanism in humans 




AJHG 2004 74793 myotonic
Summary: Multisystem disorder with complex pathogenesis 


Fragile-X Syndrome (Clinical Case Study #15)  


Called this because under certain conditions, an end of the X chromosome seems to be breaking off.  
frax chromo cartoon meh
Mental retardation   Physical Findings (males) 
  Males moderate       Head somewhat large before  
    3-6% of MR in boys with            puberty 
   positive family history of       Prominent ears, jaw and forehead 
   MR and no birth defects           after puberty  
  Females mild       Macroorchidism 
 
Behavioral Problems Inheritance pattern (Unusual) 
 Hyperactivity, tantrums      Some obligate carrier males are 
     Autistic features          phenotypically normal.  Referred to as                “normal transmitting males” (NTM). 

1/1250 males and 1/2000 females All ethnic groups 









Promoter       Exon 1                                   Exons 2-17 


ATG  
(CGG)n 

5’ UTR 

The Fragile-X syndrome is caused by expansion of a triplet/trinucleotide (CGG) repeat in the 5’ untranslated region (UTR) of exon 1 of the FMR1 gene 

•
  The pathogenic mechanism appears to involve “loss of function” of the  FMR1 gene or its gene product FMRP  

•
  Gene is expressed in neurons as well as oligodendrocytes (myelin producing cells of CNS)  

•
   FMRP is involved with the transport of mRNA of other genes  

•
   A similar syndrome can be caused by rare FMR1 point mutations (mutant protein)   



The expansion may be small (e.g., a “premutation”) or large (e.g., a “full mutation”) [see next slide] 








Promoter        Exon 1                                  






Normal, n < 50 repeats  promoter unmethylated 
Premutation, n ~ 50-200 promoter unmethylated 
Full mutation, n > 200 promoter methylated 








x 

(CGG)n 




(Rest of gene) 
Transcription 




“Premutation” alleles are slightly expanded.  The gene can still be transcribed, but, is  potentially unstable and may expand further (e.g., to full mutation) in next generation 
Effect of different repeat sizes 

“Normal” alleles can vary inrepeat number 
Possibilities for exon 1 


“Full mutation” alleles have large expansions, are not transcribed, and cause Fragile- X syndrome 




In addition to germline instability, there can be somatic instability and thus patients may be mosaics of cell populations with differing numbers of repeats 


















Wide upward diagonal













Normal transmitting male (NTM) - Has premutation 

Unaffected female: Heterozygous for full mutation and normal allele 


Affected male: Full mutation 
Females who are heterozygotes for a full mutation and normal allele may or may not develop the syndrome (~50% mentally retarded).  Therefore, this disorder is not cleanly recessive or dominant. 



Wide upward diagonal



Generally do not reproduce 


Female: Premutation Heterozygote 














X 
Large FMR1 expansions to full mutations are usually not seen through fathers.  There may be selection against passage of large alleles through the male germ line. 

Affected female: 
Heterozygous for full mutation and normal allele 



•
  Larger premutation alleles are more likely to expand   Repeat size       Risk of expansion    50-69 repeats         <20 %   70-79                           39     80-89            76   90-99            89                  >99                         >99 %   

•
   In addition, the CGG repeat region may be interrupted by AGG triplets in one or more places.  Interrupted repeats appear to be less likely to expand than uninterrupted repeats.   



   Risk of expansion during meiosis in female FMR1 premutation carriers 

More on premutations   
•
Premutation carrier females are at 3-4 X increased risk for premature ovarian failure (POF) and early menopause.    


 
•Older premutation males may develop a neurodegenerative disorder known as Fragile X associated tremor/ataxia syndrome (FXTAS).  May occur in 25% (or more ?) of premutation males > age 50 yrs.  May also see in some female premutation carriers.  


 
•Some premutation carriers (perhaps as much as 25%) may have other manifestations such as mild cognitive and/or behavioral deficits.   

•So, the premutation state is not completely innocuous! –? RNA gain of negative function?  







Polyglutamine tract (CAG) triplet repeat diseases 

Huntington disease 
 
Spinocerebellar ataxia (multiple types) 
Spinobulbar muscular atrophy 
Macado-Joseph disease 
Dentorubropallido dysplasia 
   
Tend to be neurologic, 
some demonstrate anticipation 

Triplet  “repeats” also occur in coding regions (Result in poly “amino acid” tracts) 
It is estimated that ~ 20% of human proteins contain at least one such tract 


HD patient
Autosomal dominant  (Late onset) Clinical features:  Progressive motor, cognitive and psychiatric abnormalities. Motor: Involuntary movements (chorea, 90% of patients) cannot be suppressed voluntarily.  Rigidity later in disease. Cognitive: All aspects.  Language later in course. Behavioral disturbances: Develop later in course.  Aggression, apathy, sexual deviation Psychiatric: personality changes, affective psychosis, schizophrenia  Survive 15-18 years after diagnosis  
Huntington Disease  (Clinical case study #15 in text) 



Normal:  10-26 CAG repeats         Premutation:  27-35 repeats Reduced penetrance: 36-41 repeats  Repeat size correlates with age of onset         Adult onset:  40-55 repeats         Juvenile onset:  >60 repeats  Gender-specific anticipation  New mutations are paternally derived  80% of juvenile cases are paternally derived  Penetrance is high with larger mutant alleles (e.g., >40 repeats) and if live long enough.   Ethical issues in genetic counseling   (Presymptomatic testing)  
Huntington Disease Mostly inherited (97%), new mutation (3%) 

Polycystic kidney disease (Clinical case study # 22 in text) 

•
Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common dominant diseases in man.  1 / 300 - 1000 births 


 (Accounts for 8-10% of end-stage renal disease in US) 
 
•
Average onset in 4th decade but can present earlier  

•
90% penetrant by age 70 yr  

•
Renal:  Cysts (100%, often bilateral) Blood in urine     Adenomas       Hypertension   Kidney stones 


  
•Systemic disorder:  can affect heart, 


    liver, pancreas, cerebral vasculature  
•Polycystic liver common (75%)  


~ 10 years after renal involvement. 
 
•Genes/mutations      –PKD1 (Polycystin-1, 85% of cases) •Many different mutations 

•No common one, a high mutation rate 




–PKD2 (Polycystin-2) 






fig C-21 PKD

Graphic
NEJM 347:1504 (2002) 
MRI 


apkd mbid fig 215-10 cyst origin
Heterozygous Zygote 
Somatic tissues, including kidney tubule epithelium 

Two Hits 
Light upward diagonal
Cell division, development 

Light upward diagonal






Mut 
Norm 











































Second hit in one cell 


Cyst 
apkd mbid fig 215-10 cyst origin




•
 It has been found that in (at least some cases), there has been second hit that results in loss of function at the cellular level. 

•
Second hit: (various possibilities)    Mutation of normal allele    Deletion of normal allele •
Loss of Heterozygosity (LOH)  




•
  Although two hits could also occur in a person who had not inherited a mutant allele, it would be rare. 

•
  Other factors besides a second hit may also impact cyst formation.   




Neurofibromatosis (NF) (Two Types, I and II)  (Type I is most common, Clinical case study #29 ) 
 Type I: Peripheral Neurofibromatosis 
  (von Recklinhausen Disease)  
–
Common, incidence of ca. 1 per 3500 

–
Full penetrance, variable expressivity 

–
Pleiotropy 



Neurologic, musculoskeletal, eye and 
skin abnormalities 
–
Defining features 



  Café au lait spots  (skin hyperpigmentation, >95%) 
   [first to appear, 6 or more for diagnosis] 
  Neurofibromas  (peripheral nerve tumor, >95%) 
   [plexiform, subcutaneous, cutaneous] 
Lisch nodules  (pigmented nodules of iris, 90-95%) 
–
Increased risk for certain neoplasms 



Optic nerve glioma, brain tumors, malignant myeloid disorders  
–
Also other features: E.g., axillary freckling (not exposed to sun)  




NF clinical
nf cafe-au-lait
Neurofibromas 

Café au lait 
Lisch nodules
Lisch nodules 

Pathogenesis 
    Due to loss of function 
    Can find “loss of heterozygosity” in  some tumors (two hits) 
     The activity of the normal allele is lost.    Will hear of this idea again for cancer. 
    May demonstrate segmental mosaicism 

NF1 gene (encodes neurofibromin)  Over 500 different mutations About 50% are new (de novo) mutations       (often unique to a family)  ~ 80% of de novo are paternal      (no apparent age effect) Typically a clinical diagnosis Tumor suppressor gene      One function is to regulate Ras 
NF mosaic AJHG 81:243-251 2007 
NF AJHG 81-444  600

Hemophilia A (X-linked recessive, clinical case study # 18) 
 If have 25% of factor VIII – normal 
 
 Minimal symptoms till < 5% factor VIII 
 
 <1% factor VIII, severe disease 
   (70% of cases) 
     frequent bleeding 
(spontaneous or after minimal trauma) 
    bleeding into joints (hemarthrosis) is 
      common 

hemophilia text 7-18
Gene: Large, 186 kb, 26 exons 
 Variety of mutations (large or small deletions, insertions,  missense, etc) 


 
•In 40-50% of severe cases, no FVIII mutation found by standard screens 


 
•Common inversion disrupts gene (~45% of cases) 


 
•Happens in male meiosis (paternal) 



Hemophilia A (cont) Unusual crossing over / recombination 
fig 6-2
X chromosome before inversion 
See text page 180 

X chromosome after inversion 



Charcot-Marie-Tooth (CMT) disease (Hereditary motor and sensory neuropathy, HMSN) (Clinical case study # 6 in text) 

•
Multiple HSMN types (dominant and recessive) 


  - Clinically variable presentation / severity 
  
•Type 1 (Autosomal dominant, CMT1) 


 
– Slowly progressive distal wasting and weakness first in the legs (arms later), difficulty walking, loss of reflexes, loss of sensation in limbs fingers and toes. 

–Segmental demyelination of nerves of the peripheral nervous system (PNS) often accompanied by altered nerve conduction velocities, hypertrophic changes and “onion bulb” formation.  


•CMT1 frequently (70-80%) caused by duplication of the gene for a structural protein of PNS myelin, PMP-22. 



fig C-4 CMT



Wide upward diagonal
Wide upward diagonal
Wide upward diagonal
PMP-22 
PMP-22 
PMP-22 
Chr 17 



Wide upward diagonal





X 

Repeated sequences on each side of gene lead to misalignment, recombination and gene duplication 
PMP-22 


fam hyperchol text 7-12
LDL receptor 


Fig 11-11
Globin 
Alpha globin deletions are a cause of alpha thalassemia 

End